• Question: How are the concepts of DNA, genes, proteins and the characteristics of living organisms related?

    Asked by Ana María to Tom, Paul, Natasha, Ildiko, Ester, Eoin on 6 Nov 2017.
    • Photo: Ester Gil Vazquez

      Ester Gil Vazquez answered on 6 Nov 2017:

      Really wide and nice question: let’s take it by parts.
      The DNA is a sequence of nucleotides (represented as a combination of 4 letters: TCGA), for example: TGCCAGTCCCGGTAAAGGGGCCCCGTAGG […]
      Genes are bits of this sequence that code for proteins and the proteins determine the characteristics of the living organisms.

      That means that we have certain characteristics (like blue eyes) because we express particular proteins and we do express these proteins because it is coded in our genes.

      Of course, things are not as easy: many of our characteristics (specially the complex ones) are also shaped by our experiences (where we live, what we eat, if we are stressed or lead a chill life…).

    • Photo: Paul McKeegan

      Paul McKeegan answered on 6 Nov 2017:

      Nice question Ana Maria and nice answer from Ester!
      Being a metabolism nerd I want to make a small addition to Ester’s comments. (Please excuse me!)

      You need energy to replicate DNA and arrange it into the correct sequence to make genes.
      You need energy to read a gene and make a protein.
      You need energy for the proteins to function, whether as part of cell-cell communication, growth and repair, breaking down food to release more energy or storing energy as fat or carbohydrate.

      So my answer to this is that DNA, genes, proteins and everything else are related and made possible through energy!

Comments